Review



human kidney epithelial cell line 293t atcc n a mouse  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC human kidney epithelial cell line 293t atcc n a mouse
    Human Kidney Epithelial Cell Line 293t Atcc N A Mouse, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 38071 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+kidney+epithelial+cell+line+293t+atcc+n+a+mouse/293T/pm40239628-273-158-164
    Average 99 stars, based on 38071 article reviews
    human kidney epithelial cell line 293t atcc n a mouse - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Adjuvant:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Saline:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    CRISPR:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    CCK-8 Assay:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Extraction:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Molecular Weight:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    RNA Sequencing:

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.

    Article Title: Specific macrophage RhoA targeting CRISPR-Cas9 for mitigating osteoclastogenesis-induced joint damage in inflammatory arthritis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membranes Roche Cat# 3010040001 Immune-grade chicken type II collagen Chondrex Cat# 20012 Complete Freund’s Adjuvant Chondrex Cat# 7009 Saline YuanYe Cat# R22172 CRISPR-Cas9 plasmids Yunzhou Biosciences Cat# MidH(VB220809-1062vdw) Critical commercial assays IL-6 ELISA Kit Ruixin Biotech Cat# RX203049M IL-23 ELISA Kit Ruixin Biotech Cat# RX203058M TNF-a ELISA Kit Ruixin Biotech Cat# RX202412M TRAP kit Roles-Bio Cat# RBG1055-100 Cell Counting Kit-8 TargetMol Cat# C0005 Extraction kit for lymphocytes Solarbio Cat# PB620 Extraction kit for neutrophils Solarbio Cat# P9201 Extraction kit for monocytes Solarbio Cat# P5230 Protein molecular weight ladder YEASEN 20347ES72 GoldBand 500 bp DNA Ladder YEASEN 10518ES60 Mycoplasma Detection Kit Soleibao Cat# CA1080 Deposited data RNA Sequencing data This paper GEO:GSE289266 Original data This paper https://doi.org/10.17632/y4d9rzrnr6.1 Experimental models: Cell lines Mouse: Murine macrophages (RAW264.7) ATCC N/A Human: human fibroblast-like synoviocytes (MH7A) BFB N/A Mouse: mouse umbilical vein endothelial cells (MUVECs) ATCC N/A Mouse: a mouse fibroblast line (3T3) ATCC N/A Human: a human kidney epithelial cell line (293T) ATCC N/A Mouse: bone marrow-derived macrophages (BMDMs) This Paper N/A Experimental models: Organisms/strains Mouse: Male C57BL/6 mice (6–8 weeks) Vital River company In house breeding Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J mice Cyagen company In house breeding Mouse: RhoAem1(flox)Cya mice Cyagen company In house breeding Mouse: CX3CR-1GFP mice (strain name: B6.129P2(Cg)-Cx3cr1tm1Litt/J) The Jackson Laboratories In house breeding Oligonucleotides LoxP-1 F: CTCAAAGCCTTGTACAGGTTGAAA; R: AATATACGTAGAAGCCCCACAGAC.



    Similar Products

    99
    ATCC human kidney epithelial cell line 293t atcc n a mouse
    Human Kidney Epithelial Cell Line 293t Atcc N A Mouse, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+kidney+epithelial+cell+line+293t+atcc+n+a+mouse/293T/pm40239628-273-158-164
    Average 99 stars, based on 1 article reviews
    human kidney epithelial cell line 293t atcc n a mouse - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results